Stem-loop sequence mtr-MIR5274b

AccessionMI0019080 (change log)
DescriptionMedicago truncatula miR5274b stem-loop
Gene family MIPF0001311; MIR5274
Literature search

1 open access papers mention mtr-MIR5274b
(1 sentences)

Stem-loop
   -      cg                         a      ga  ua 
5'  gcguuc  caauaugacggaguguaaaugccua guauca  cu  c
    ||||||  ||||||||||||||||||||||||| ||||||  ||   
3'  cgcaag  guuauacugccucacauuuacggau cauagu  ga  c
   a      au                         a      uc  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 12634036-12634130 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR5274b
mtr-MIR5274achr4: 12634031-12634133 [-]
mtr-MIR5274bchr4: 12634036-12634130 [+]
Database links

Mature sequence mtr-miR5274b-5p

Accession MIMAT0022209
Previous IDsmtr-miR5274b
Sequence

11 - 

auaugacggaguguaaaugcc

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR5274b-3p

Accession MIMAT0022210
Previous IDsmtr-miR5274b*
Sequence

66 - 

cauuuacacuccgucauauug

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1