Stem-loop sequence mtr-MIR2592bl

AccessionMI0019078 (change log)
DescriptionMedicago truncatula miR2592bl stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bl
(2 sentences)

Stem-loop
   ag                       u  cu      a   uaa          u          g 
5'   uuguuguuuggcaaguuugaauu ac  cauuca agg   gauaauuguu uaguuggaag u
     ||||||||||||||||||||||| ||  |||||| |||   |||||||||| ||||||||||  
3'   gacggcaaauuguucaaacuuaa ug  guaggu ucc   cuguuaacaa aucaaccuuc g
   ag                       -  ag      c   -uc          c          c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 20867262-20867391 [+]
intergenic
Database links

Mature sequence mtr-miR2592bl-5p

Accession MIMAT0022205
Previous IDsmtr-miR2592bl
Sequence

11 - 

uggcaaguuugaauuuaccuca

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR2592bl-3p

Accession MIMAT0022206
Previous IDsmtr-miR2592bl*
Sequence

102 - 

gaguaauucaaacuuguuaaa

 - 122

Get sequence
Evidence experimental; Illumina [1]

References

1