Stem-loop sequence mtr-MIR2619b

AccessionMI0019077 (change log)
DescriptionMedicago truncatula miR2619b stem-loop
Gene family MIPF0001294; MIR2619
Literature search

1 open access papers mention mtr-MIR2619b
(1 sentences)

Stem-loop
   aaa       a     u                    gc      aggcaaaauaaaaauaaaaaauuugacacauggcaccuc 
5'    cagcccc uaugu uugauucuuuggcaguuuug  ccccca                                       a
      ||||||| ||||| ||||||||||||||||||||  ||||||                                       c
3'    gucgggg auaca aacuaagaaaccgucaaaac  gggggu                                       u
   uua       g     u                    uu      caagucacaacugagccaguugcgacugcaccgugggau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 7493105-7493275 [+]
intergenic
Database links

Mature sequence mtr-miR2619b-5p

Accession MIMAT0022203
Previous IDsmtr-miR2619b
Sequence

11 - 

auauguuuugauucuuuggca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR2619b-3p

Accession MIMAT0022204
Previous IDsmtr-miR2619b*
Sequence

143 - 

ccaaagaaucaauacauaggg

 - 163

Get sequence
Evidence experimental; Illumina [1]

References

1