Stem-loop sequence mtr-MIR5554a

AccessionMI0019075 (change log)
DescriptionMedicago truncatula miR5554a stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR5554a
(1 sentences)

Stem-loop
   -      g     u      ug   a             g      -    c 
5'  cagcau cgaug gcaucu  aac augguauucaagu ucaaga aaug a
    |||||| ||||| ||||||  ||| ||||||||||||| |||||| |||| c
3'  guugua gcuac cguaga  uug uaccauaaguuca aguuuu uuac c
   g      g     u      cg   c             a      c    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 32660180-32660284 [-]
intergenic
Database links

Mature sequence mtr-miR5554a-5p

Accession MIMAT0022199
Previous IDsmtr-miR5554a
Sequence

11 - 

ugugcaucuugaacaaugguau

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR5554a-3p

Accession MIMAT0022200
Previous IDsmtr-miR5554a*
Sequence

75 - 

accaucguugcagaugcucauc

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1