Stem-loop sequence osa-MIR5540

AccessionMI0019061 (change log)
DescriptionOryza sativa miR5540 stem-loop
Gene family MIPF0001604; MIR5160
Literature search

1 open access papers mention osa-MIR5540
(1 sentences)

Stem-loop
   u       u      a                  ucgcacaacc                 u ga      a      a          cauugaaa  a         accgugcacgauaauuaaucacuaauuauuauuagcuaauaguuaauuauguacuugaucacuaauu 
5'  uuugcga aauaua cgucgaucucgcacgauc          guugcgcgaaaaugacg g  ugugac uugcag cgguauugcg        gu cgagaccgc                                                                   a
    ||||||| |||||| ||||||||||||||||||          ||||||||||||||||| |  |||||| |||||| ||||||||||        || |||||||||                                                                    
3'  aaacgcu uuauau gcagcuagagcguguuag          uaacgcgcuuuuauugc u  gcacug agcguc gccauagcgc        ca gcucuggcg                                                                   a
   -       u      g                  ----------                 c ac      c      c          acccgaua  c         cgccagaaugcuuuacuuucucgcuccagaacgacuuugucagacgcugucauaauuggccgaggua 
Get sequence
Deep sequencing
184 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 35552728-35553070 [-]
intergenic
Database links

Mature sequence osa-miR5540

Accession MIMAT0022176
Sequence

313 - 

uugugcgagaucgacgguaua

 - 333

Get sequence
Deep sequencing155 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1