Stem-loop sequence osa-MIR5538

AccessionMI0019059 (change log)
DescriptionOryza sativa miR5538 stem-loop
Literature search

1 open access papers mention osa-MIR5538
(1 sentences)

Stem-loop
   augag        -ga     -a  a   -g  g     acucaacaguuuucuguugaggu 
5'      gaacuacu   acuca  uc cuu  cu ccguu                       c
        ||||||||   |||||  || |||  || |||||                       u
3'      cuugaugg   ugagu  ag gag  ga ggcaa                       a
   gguaa        gga     gg  -   ag  g     gauuaaacugauggagaugcccu 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 21337283-21337405 [+]
intergenic
Database links

Mature sequence osa-miR5538

Accession MIMAT0022174
Sequence

11 - 

acugaacucaaucacuugcugc

 - 32

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

References

1