Stem-loop sequence osa-MIR5528

AccessionMI0019048 (change log)
DescriptionOryza sativa miR5528 stem-loop
Literature search

2 open access papers mention osa-MIR5528
(2 sentences)

Stem-loop
   g  -     uuu         -uu   aag    -  ua 
5'  ac aucag   gcaguaucu   acc   gucu gg  c
    || |||||   |||||||||   |||   |||| ||   
3'  ug uaguc   cguuguaga   ugg   caga cc  u
   -  c     cuc         uuu   ---    a  cg 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 9586987-9587059 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5528
osa-MIR5527Chr11: 9589960-9590324 [+]
osa-MIR5528Chr11: 9586987-9587059 [-]
Database links

Mature sequence osa-miR5528

Accession MIMAT0022163
Sequence

43 - 

aagacgguuuuagauguugcc

 - 63

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1