Stem-loop sequence osa-MIR5522

AccessionMI0019041 (change log)
DescriptionOryza sativa miR5522 stem-loop
Stem-loop
   agcac      a aa            g   -u        u      caaguc    ca 
5'      cuaaga c  uaggaaugggag cau  aggaaagu gcaagc      ucca  a
        |||||| |  |||||||||||| |||  |||||||| ||||||      ||||   
3'      gauucu g  auccuuacccuu gua  uccuuuca cguucg      aggu  a
   uccca      c ac            -   cc        -      ------    ac 
Get sequence
Deep sequencing
49 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21650324-21650436 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5522
osa-MIR2118aChr4: 21642923-21643101 [-]
osa-MIR1869Chr4: 21644852-21644989 [+]
osa-MIR2118bChr4: 21645285-21645463 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118mChr4: 21658851-21659020 [-]
Database links

Mature sequence osa-miR5522

Accession MIMAT0022156
Sequence

11 - 

aacaauaggaaugggaggcau

 - 31

Get sequence
Deep sequencing49 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1