Stem-loop sequence osa-MIR5519

AccessionMI0019038 (change log)
DescriptionOryza sativa miR5519 stem-loop
Literature search

2 open access papers mention osa-MIR5519
(5 sentences)

Stem-loop
   c         u       - ua     --      g 
5'  ugugggcgu ggcagaa g  cugga  cuuagc g
    ||||||||| ||||||| |  |||||  ||||||  
3'  acgccugua ucgucuu c  gacuu  ggaucg g
   u         -       a uc     cg      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 24358353-24358422 [+]
intergenic
Database links

Mature sequence osa-miR5519

Accession MIMAT0022153
Sequence

11 - 

uggcagaaguacuggacuuag

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).