Stem-loop sequence osa-MIR5516a

AccessionMI0019035 (change log)
Previous IDsosa-MIR5516
DescriptionOryza sativa miR5516a stem-loop
Gene family MIPF0001595; MIR5516
Literature search

3 open access papers mention osa-MIR5516a
(4 sentences)

Stem-loop
   ggaggugggagucaaaccaua       -   u  g      aagca    gaa 
5'                      ucaguuu ccg gg agugag     uggg   a
                        ||||||| ||| || ||||||     ||||   u
3'                      ggucgga ggc uc uuacuc     accc   u
   -----------cuuaaccagc       u   u  g      ----a    gau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 13979418-13979512 [-]
intergenic
Database links

Mature sequence osa-miR5516a

Accession MIMAT0022150
Previous IDsosa-miR5516
Sequence

65 - 

cucauugcuucgguaggcugg

 - 85

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).