Stem-loop sequence osa-MIR5516a

Accession

MI0019035 (change log)

Previous IDs

osa-MIR5516

Description

Oryza sativa miR5516a stem-loop

Gene family

MIPF0001595; MIR5516

Literature search

3 open access papers mention osa-MIR5516a
(4 sentences)

Stem-loop

   ggaggugggagucaaaccaua       -   u  g      aagca    gaa 
5'                      ucaguuu ccg gg agugag     uggg   a
                        ||||||| ||| || ||||||     ||||   u
3'                      ggucgga ggc uc uuacuc     accc   u
   -----------cuuaaccagc       u   u  g      ----a    gau 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr5: 13979418-13979512 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0019035

Mature sequence osa-miR5516a

• Accession: MIMAT0022150
• Previous IDs: osa-miR5516
• Sequence: 65 - cucauugcuucgguaggcugg - 85
• Evidence: experimental; Illumina [1-2]

References

1. PMID:21679406 "Deep sequencing on genome-wide scale reveals the unique composition and expression patterns of microRNAs in developing pollen of Oryza sativa" Wei LQ, Yan LF, Wang T Genome Biol. 12:R53(2011).
2. PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).