Stem-loop sequence osa-MIR5515

AccessionMI0019034 (change log)
DescriptionOryza sativa miR5515 stem-loop
Stem-loop
   aa       ggu   g   gg   a      -  -   uaauuggaaugagagacuucgggagu 
5'   auuguuu   uca uug  gag cgauca cg ccu                          u
     |||||||   ||| |||  ||| |||||| || |||                           
3'   uaacaaa   agu gac  cuu guuggu gc ggg                          u
   ug       ---   g   au   -      a  c   uaaacccacagguuuaucuuauugau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 17244138-17244261 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5515
osa-MIR5499Chr4: 17241717-17241841 [+]
osa-MIR5515Chr4: 17244138-17244261 [+]
Database links

Mature sequence osa-miR5515

Accession MIMAT0022149
Sequence

94 - 

ccgaugguuguucuacaggug

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1