Stem-loop sequence osa-MIR2275c

AccessionMI0019032 (change log)
DescriptionOryza sativa miR2275c stem-loop
Gene family MIPF0000797; MIR2275
Literature search

14 open access papers mention osa-MIR2275c
(70 sentences)

Stem-loop
   a     a      -               a    u  c      -a    u   a 
5'  cugga gugaga auuggaggaaaacaa cuga ug ugguug  ugcu gca c
    ||||| |||||| ||||||||||||||| |||| || ||||||  |||| |||  
3'  gacuu cacucu uaaccucuuuuuguu gacu au auuaac  acgg ugu a
   g     c      a               a    u  a      aa    -   g 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 16719772-16719880 [-]
intergenic
Database links

Mature sequence osa-miR2275c

Accession MIMAT0022147
Sequence

11 - 

agaauuggaggaaaacaaacuga

 - 33

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1