Stem-loop sequence osa-MIR5513

AccessionMI0019031 (change log)
DescriptionOryza sativa miR5513 stem-loop
Literature search

3 open access papers mention osa-MIR5513
(5 sentences)

Stem-loop
   g                c            g            uacuuauacguuuguucauuuaggauaga 
5'  ucauuauucuucaguc guuguccuuugu auaacauaucug                             c
    |||||||||||||||| |||||||||||| ||||||||||||                             a
3'  aguaauaagaagucag caacaggaaaca uauuguauaggc                             a
   -                a            a            cgauuacagucgaucgcaccgaaacucgg 
Get sequence
Deep sequencing
22 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 34008003-34008148 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5513
osa-MIR1865Chr3: 34000594-34000737 [+]
osa-MIR5513Chr3: 34008003-34008148 [+]
Database links

Mature sequence osa-miR5513

Accession MIMAT0022146
Sequence

116 - 

uaacaaaggacaacagacuga

 - 136

Get sequence
Deep sequencing19 reads, 2 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).