Stem-loop sequence osa-MIR5512a

AccessionMI0019030 (change log)
Previous IDsosa-MIR5512
DescriptionOryza sativa miR5512 stem-loop
Gene family MIPF0001478; MIR5512
Literature search

1 open access papers mention osa-MIR5512a
(2 sentences)

Stem-loop
   c  u          uu                                  auauacuagaguauguucu 
5'  uc uguauuuuuu  uagcauuaccauauccuauuuggcaaugaauuuc                   u
    || ||||||||||  ||||||||||||||||||||||||||||||||||                    
3'  ag acauaaaaaa  aucguaaugguauaggauaaaccguuacuuaaag                   a
   -  u          --                                  ugaaaucuguuagguuaga 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 18386976-18387112 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5512a
osa-MIR5512aChr4: 18386976-18387112 [+]
osa-MIR5512bChr4: 18386979-18387110 [-]
Database links

Mature sequence osa-miR5512a

Accession MIMAT0022145
Previous IDsosa-miR5512
Sequence

107 - 

uaggauaugguaaugcuaaaa

 - 127

Get sequence
Deep sequencing33 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1