Stem-loop sequence osa-MIR5509

AccessionMI0019027 (change log)
DescriptionOryza sativa miR5509 stem-loop
Literature search

1 open access papers mention osa-MIR5509
(2 sentences)

Stem-loop
   ----------------------------------------------------------------uuuccaagccuaggcauuuucucuuggcaugcu   c     a  -       aca    a    ---      gu         gca 
5'                                                                                                  gug agcuu uu ccaggaa   uuau uuga   acuuua  agaggaauu   u
                                                                                                    ||| ||||| || |||||||   |||| ||||   ||||||  |||||||||   a
3'                                                                                                  uac ucgga ag gguuuuu   aaug aacu   ugaagu  ucuuuuuga   u
   uuggguuguuucuuuauuguuagugucccgcuauccggacugguaaagcuuagguuuccgugcguaauccgugaucugccauagggacgauaggguu   a     c  u       aua    -    gaa      --         aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 24258580-24258815 [-]
intergenic
Database links

Mature sequence osa-miR5509

Accession MIMAT0022142
Sequence

11 - 

uaggcauuuucucuuggcaug

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1