Stem-loop sequence osa-MIR5508

Accession

MI0019026 (change log)

Description

Oryza sativa miR5508 stem-loop

Literature search

2 open access papers mention osa-MIR5508
(4 sentences)

Stem-loop

   gcu   g                    g   c        ggguaagaaggauuggccucugucuagugccucac 
5'    auu aacuagauggcugaucuggu ugg uuggcuuu                                   u
      ||| |||||||||||||||||||| ||| ||||||||                                   u
3'    uga uugaucuaccgacuagaccg acc aacugaag                                   u
   cuc   g                    a   a        aagguuugguccugucaucugucuuggcgucuucc 

Deep sequencing

69 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr6: 638203-638355 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0019026

Mature sequence osa-miR5508

• Accession: MIMAT0022141
• Sequence: 11 - uagauggcugaucuggugugg - 31
• Deep sequencing: 66 reads, 2 experiments
• Evidence: experimental; Illumina [1-2]
• Database links:
  • RNAcentral:URS000055BF88_39947

References

1. PMID:21679406 "Deep sequencing on genome-wide scale reveals the unique composition and expression patterns of microRNAs in developing pollen of Oryza sativa" Wei LQ, Yan LF, Wang T Genome Biol. 12:R53(2011).
2. PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).