Stem-loop sequence osa-MIR5506

AccessionMI0019024 (change log)
DescriptionOryza sativa miR5506 stem-loop
Literature search

2 open access papers mention osa-MIR5506
(2 sentences)

Stem-loop
   acca  ug a  g    - u  gu  -     u ------      uugac   a  gg 
5'     gu  u ug aucg c uc  cu gaugg c      cuccua     uca gu  a
       ||  | || |||| | ||  || ||||| |      ||||||     ||| ||  c
3'     ca  a ac uagc g ag  ga cuacc g      gaggau     agu ca  g
   guua  gu g  g    u c  ug  a     c acucgu      -ccca   -  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 15164737-15164847 [-]
intergenic
Database links

Mature sequence osa-miR5506

Accession MIMAT0022139
Sequence

11 - 

uggaucgcuucgucugauggu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1