Stem-loop sequence osa-MIR5504

AccessionMI0019022 (change log)
DescriptionOryza sativa miR5504 stem-loop
Literature search

3 open access papers mention osa-MIR5504
(8 sentences)

Stem-loop
   auu      uuuu uu g   g  c  g          --u     g -  u 
5'    gcugaa    g  c uug ag uu uucuguuauu   uauuu c ac g
      ||||||    |  | ||| || || ||||||||||   ||||| | ||  
3'    cgacuu    c  g aac uc ag agggcaguga   auaaa g ug c
   uuu      ---- uu g   g  -  g          cac     g a  c 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 17228165-17228262 [-]
intergenic
Database links

Mature sequence osa-miR5504

Accession MIMAT0022137
Sequence

66 - 

agugacgggaggacugcaagg

 - 86

Get sequence
Deep sequencing10 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1