Stem-loop sequence osa-MIR5499

AccessionMI0019017 (change log)
DescriptionOryza sativa miR5499 stem-loop
Literature search

1 open access papers mention osa-MIR5499
(1 sentences)

Stem-loop
   u     --u        uu         a     g      -a      cg   -accuu   u 
5'  ucugc   guuccaug  cgauucuuc uuugg gaucua  caucag  gga      aag c
    |||||   ||||||||  ||||||||| ||||| ||||||  ||||||  |||      |||  
3'  agacg   uaagguau  gcuaagaag aagcc uuagau  guaguu  ccu      uuc u
   u     uag        -u         g     g      ag      ua   auacac   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 17241717-17241841 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5499
osa-MIR5499Chr4: 17241717-17241841 [+]
osa-MIR5515Chr4: 17244138-17244261 [+]
Database links

Mature sequence osa-miR5499

Accession MIMAT0022132
Sequence

95 - 

gaaggaagaaucguuauggaa

 - 115

Get sequence
Evidence experimental; Illumina [1]

References

1