Stem-loop sequence osa-MIR5497

AccessionMI0019015 (change log)
DescriptionOryza sativa miR5497 stem-loop
Literature search

3 open access papers mention osa-MIR5497
(6 sentences)

Stem-loop
   aauug       ---      c     c   ca  auaacaugugcacaguauagcucggacuuguuaau 
5'      uugccca   gaauau uggga gag  ug                                   c
        |||||||   |||||| ||||| |||  ||                                    
3'      gaugggu   uuugua aucuu cuc  ac                                   u
   cgaua       ucu      u     -   ac  acucuuaccuuccguaacccucucgguuguaaucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 32506012-32506149 [+]
intergenic
Database links

Mature sequence osa-miR5497

Accession MIMAT0022130
Sequence

11 - 

cagaauaucugggacgagcau

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1