Stem-loop sequence osa-MIR5491

AccessionMI0019009 (change log)
DescriptionOryza sativa miR5491 stem-loop
Literature search

1 open access papers mention osa-MIR5491
(2 sentences)

Stem-loop
   acc       auug     cu    g            cacguauacuuucacagacaua 
5'    augcggc    acaau  gagu cuucauuuuaua                      a
      |||||||    |||||  |||| ||||||||||||                       
3'    uguguug    uguug  cucg gagguaaagugu                      g
   cca       --ca     --    -            uaaaaaacuauguguugcacga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 6896342-6896458 [+]
intergenic
Database links

Mature sequence osa-miR5491

Accession MIMAT0022124
Sequence

87 - 

ugaaauggaggcucguuguac

 - 107

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).