Stem-loop sequence osa-MIR5490

AccessionMI0019008 (change log)
DescriptionOryza sativa miR5490 stem-loop
Literature search

1 open access papers mention osa-MIR5490
(2 sentences)

Stem-loop
   g       --a         -    cc   u  ag    -        --g   a 
5'  cuacucc   uguccuaaa gaaa  uca uc  aagg uguaccug   aug c
    |||||||   ||||||||| ||||  ||| ||  |||| ||||||||   ||| a
3'  gaugagg   gcaggauuu uuuu  ggu ag  uucc acauggac   uau u
   g       gag         a    ua   u  aa    u        aua   g 
Get sequence
Deep sequencing
87 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 25091558-25091664 [-]
intergenic
Database links

Mature sequence osa-miR5490

Accession MIMAT0022123
Sequence

77 - 

uuggauuuuuauuuaggacgg

 - 97

Get sequence
Deep sequencing19 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1