Stem-loop sequence osa-MIR5487

AccessionMI0019005 (change log)
DescriptionOryza sativa miR5487 stem-loop
Literature search

2 open access papers mention osa-MIR5487
(3 sentences)

Stem-loop
   ag      uaaa  a    -        u c    --     aagcgaguuugguguuaugacaagcugguuggaguacucguauuugaugaacauccucauuuuaaaauu 
5'   aacagc    ag ugug cauguagu c ggcu  uaauu                                                                     u
     ||||||    || |||| |||||||| | ||||  |||||                                                                     u
3'   uugucg    uc acac guacguua g ccgg  auuaa                                                                     a
   gg      -cca  -    u        u u    ua     aauucauacccuucucucguauacguaucgguacuacgguagaugaguuauaaagugagaagguuagua 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 17569162-17569381 [+]
intergenic
Database links

Mature sequence osa-miR5487

Accession MIMAT0022120
Sequence

11 - 

aaagaugugcauguaguuccg

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1