Stem-loop sequence osa-MIR5486

AccessionMI0019004 (change log)
DescriptionOryza sativa miR5486 stem-loop
Literature search

4 open access papers mention osa-MIR5486
(5 sentences)

Stem-loop
   uu   u  -aaa       -   u      ccaccc c    -  ag 
5'   gcg ug    ggggcuu gca auucua      g uuga gc  u
     ||| ||    ||||||| ||| ||||||      | |||| ||   
3'   cgc ac    cuccggg cgu uaggau      c aacu cg  g
   gu   c  cucg       u   u      ------ c    a  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 26838891-26838977 [+]
intergenic
Database links

Mature sequence osa-miR5486

Accession MIMAT0022119
Sequence

11 - 

aggggcuugcauauucuacca

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1