Stem-loop sequence osa-MIR5485

AccessionMI0019003 (change log)
DescriptionOryza sativa miR5485 stem-loop
Literature search

3 open access papers mention osa-MIR5485
(9 sentences)

Stem-loop 
   -         g      c     g             u uccacuu      u      g u 
5'  cuuggagug ugacaa uggua cagagcaauguca c       gccggu guuccu g a
    ||||||||| |||||| ||||| ||||||||||||| |       |||||| |||||| | u
3'  ggaucucac gcuguu accau gucucguuacagu g       ugguca uaggga c g
   c         g      a     a             c -------      -      g u
Get sequence
Deep sequencing
14 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 22088075-22088192 [-]
intergenic
Database links

Mature sequence osa-miR5485

Accession MIMAT0022118
Sequence

11 -  

ugacaacugguagcagagcaa

 - 31

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
PMID:21679406 "Deep sequencing on genome-wide scale reveals the unique composition and expression patterns of microRNAs in developing pollen of Oryza sativa" Wei LQ, Yan LF, Wang T Genome Biol. 12:R53(2011).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).