Stem-loop sequence osa-MIR5484

AccessionMI0019002 (change log)
DescriptionOryza sativa miR5484 stem-loop
Literature search

1 open access papers mention osa-MIR5484
(3 sentences)

Stem-loop
   ggcggccggcugcggcgacggcggcuuggaugggucgccuuccucccuugcugcucggaugaacccucgccgcaugcaucg     uu  uauu uu    -ug     aau    ucucuuuuuuaucccccuuacgguucuugaucu 
5'                                                                                  cgauc  ga    c  ggca   gaauu   agcg                                 c
                                                                                    |||||  ||    |  ||||   |||||   ||||                                  
3'                                                                                  guuag  cu    g  uugu   uuuaa   ucgc                                 c
   ----cucuauucuaauuaguugucgcgcgagccaaaacguuguagcguacguaggugucgugucgacuaguccguugguua     cu  -uuu uu    uca     --c    ucguucuucuuggucucuuaagucucuucgcga 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 7796922-7797213 [-]
intergenic
Database links

Mature sequence osa-miR5484

Accession MIMAT0022117
Sequence

262 - 

aaccgagcgcgcuguugauua

 - 282

Get sequence
Evidence experimental; Illumina [1]

References

1