Stem-loop sequence pti-MIR5475

AccessionMI0018993 (change log)
DescriptionPhaeodactylum tricornutum miR5475 stem-loop
Stem-loop
   cgg     cgc    u   ga       g    ugaucgucuugugauaccggauuuacaaguaacgaaaauggacaacuuuaagagucucugugucggggccagugacu 
5'    uuugg   gaac gcg  aauuuuu cggc                                                                             g
      |||||   |||| |||  ||||||| ||||                                                                             g
3'    gaacc   uuug ugc  uuaggag gcug                                                                             a
   cua     auu    c   aa       -    cggguaaguuuuuucuauuuaucuggcuguccuuuagcucuuuguuguauggaagaguaacguaagaagcuagagcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15095v2; GCA_000150955.2) Overlapping transcripts
CM000620.1: 415320-415541 [-]
intergenic
Database links

Mature sequence pti-miR5475

Accession MIMAT0022108
Sequence

192 - 

ucggaggauuaacgucguuuu

 - 212

Get sequence
Evidence experimental; Illumina [1]

References

1