Stem-loop sequence pti-MIR5474

AccessionMI0018992 (change log)
DescriptionPhaeodactylum tricornutum miR5474 stem-loop
Stem-loop
   gaguggcguuccccguuugcauuuccgucaacgacauugucugcaaucauucgcccuugccaaacgaagaacggguaa   c  -  -     u   a  gagaaaa      u 
5'                                                                               gug cg uc ccaug ggu ua       auggcg a
                                                                                 ||| || || ||||| ||| ||       ||||||  
3'                                                                               cac gc gg ggugu cca au       ugccgu c
   -----------------------------------------------------------------agcaccguaugaa   a  u  u     -   -  -aaaaca      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15095v2; GCA_000150955.2) Overlapping transcripts
CM000617.1: 663006-663165 [+]
intergenic
Database links

Mature sequence pti-miR5474

Accession MIMAT0022107
Sequence

129 - 

aaccugugguggucgacacaag

 - 150

Get sequence
Evidence experimental; Illumina [1]

References

1