Stem-loop sequence pti-MIR5473

AccessionMI0018991 (change log)
DescriptionPhaeodactylum tricornutum miR5473 stem-loop
Stem-loop
   a  u    --   g     ---a        aa   agugu     u  ug  u 
5'  gu cuac  gcu aggua    cgggauca  ggu     uuucg ag  uu u
    || ||||  ||| |||||    ||||||||  |||     ||||| ||  ||  
3'  cg gaug  ugg uccgu    gccuuagu  cua     gaagu uu  ga c
   a  u    ga   g     guua        cg   ---gu     -  gu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15095v2; GCA_000150955.2) Overlapping transcripts
CP001141.1: 35406-35506 [-]
intergenic
Database links

Mature sequence pti-miR5473

Accession MIMAT0022106
Sequence

11 - 

ugagguaacgggaucaaagg

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1