Stem-loop sequence amg-MIR396

AccessionMI0018987 (change log)
DescriptionAcacia mangium miR396 stem-loop
Gene family MIPF0000047; MIR396
Literature search

2 open access papers mention amg-MIR396
(6 sentences)

Stem-loop
   --cua       c       uc            c          ucgauc     ---aaga   a  uu   ucu 
5'      uggcucu ucuguau  uuccacagcuuu uugaacugca      gaaga       gca gc  ugu   c
        ||||||| |||||||  |||||||||||| ||||||||||      |||||       ||| ||  |||    
3'      acuggga agacaua  agggugucgaaa aacuuggcgu      cuucu       cgu cg  aca   u
   cacca       u       ga            u          -----u     gcuaaac   a  -u   uuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence amg-miR396

Accession MIMAT0022680
Sequence

21 - 

uuccacagcuuucuugaacug

 - 41

Get sequence
Evidence not experimental

References

1