Stem-loop sequence aca-mir-5452

AccessionMI0018956 (change log)
DescriptionAnolis carolinensis miR-5452 stem-loop
Stem-loop
   -  a  -    c     ug       u    c  c    gucca 
5'  ga gg gggg accuu  gcccucc guug ug ugga     g
    || || |||| |||||  ||||||| |||| || ||||     c
3'  cu cc cccc uggag  cgggagg cgac ac accu     u
   a  -  a    u     gu       c    a  a    aacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343282.1: 1468391-1468478 [+]
sense
ENSACAT00000000965 ; aca-mir-5408a-201; intron 3
Clustered miRNAs
< 10kb from aca-mir-5452
aca-mir-5452GL343282.1: 1468391-1468478 [+]
aca-mir-5408aGL343282.1: 1472516-1472599 [-]
aca-mir-5406GL343282.1: 1474906-1474981 [-]
aca-mir-5407GL343282.1: 1475305-1475385 [-]
Database links

Mature sequence aca-miR-5452-5p

Accession MIMAT0022075
Previous IDsaca-miR-5452
Sequence

16 - 

uggcccuccuguugcugcug

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-5452-3p

Accession MIMAT0022076
Previous IDsaca-miR-5452*
Sequence

53 - 

caacaacagccggagggcugg

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).