Stem-loop sequence aca-mir-5436

AccessionMI0018939 (change log)
DescriptionAnolis carolinensis miR-5436 stem-loop
Stem-loop
    ug      u          g             u   -g  a 
5' u  cuggcc caagcagcuc cuggcagagacuu cug  ug a
   |  |||||| |||||||||| ||||||||||||| |||  ||  
3' a  gacugg guucgucgag gaccguuucugaa gac  ac g
    gu      u          g             c   ag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 151844931-151845017 [+]
intergenic
Database links

Mature sequence aca-miR-5436-5p

Accession MIMAT0022057
Sequence

16 - 

agcucgcuggcagagacuuucu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-5436-3p

Accession MIMAT0022058
Sequence

53 - 

caagucuuugccagggagcug

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).