Stem-loop sequence aca-mir-5417

AccessionMI0018920 (change log)
DescriptionAnolis carolinensis miR-5417 stem-loop
Stem-loop
   u  -     acuga          c -     ag     ggc 
5'  gg ccggg     ggagagaagg g uggga  gagcg   u
    || |||||     |||||||||| | |||||  |||||    
3'  uc ggucc     ccucuuuucc c acccu  cucgc   c
   -  a     -----          c g     -a     ggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343364.1: 1077037-1077113 [-]
sense
ENSACAT00000008063 ; aca-mir-5417-201; 5'UTR (exon 1)
Clustered miRNAs
< 10kb from aca-mir-5417
aca-mir-5417GL343364.1: 1077037-1077113 [-]
aca-mir-1306GL343364.1: 1070716-1070784 [-]
Database links

Mature sequence aca-miR-5417

Accession MIMAT0022037
Sequence

49 - 

ucaucccagccccuuuucuccccu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).