Stem-loop sequence aca-mir-5412

AccessionMI0018915 (change log)
DescriptionAnolis carolinensis miR-5412 stem-loop
Stem-loop
    ug         g       uu        gugaa 
5' g  gcagagaag guccagg  uuuuucuu     u
   |  ||||||||| |||||||  ||||||||     u
3' u  cgucuuuuc ugggucu  aaaaggaa     u
    gu         g       uu        auuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343214.1: 285126-285198 [-]
sense
ENSACAT00000000317 ; XIRP2-201; intron 3
Database links

Mature sequence aca-miR-5412-5p

Accession MIMAT0022030
Sequence

10 - 

aaggguccagguuuuuuucuu

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-5412-3p

Accession MIMAT0022031
Sequence

46 - 

ggaaaauuucugggugcuuuu

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).