Stem-loop sequence aca-mir-5408a

AccessionMI0018911 (change log)
DescriptionAnolis carolinensis miR-5408a stem-loop
Gene family MIPF0001313; mir-5408
Stem-loop
     a     u     c  u      uaaug        uagc 
5' ag ggguu ggacu ua cuccca     cuuagccg    u
   || ||||| ||||| || ||||||     ||||||||     
3' uc cccaa cuuga gu gagggu     gaaucggu    c
     c     c     a  u      cuuca        gagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343282.1: 1472516-1472599 [-]
antisense
ENSACAT00000000965 ; aca-mir-5408a-201; exon 4
Clustered miRNAs
< 10kb from aca-mir-5408a
aca-mir-5407GL343282.1: 1475305-1475385 [-]
aca-mir-5406GL343282.1: 1474906-1474981 [-]
aca-mir-5408aGL343282.1: 1472516-1472599 [-]
aca-mir-5452GL343282.1: 1468391-1468478 [+]
Database links

Mature sequence aca-miR-5408a-5p

Accession MIMAT0022024
Previous IDsaca-miR-5408a
Sequence

15 - 

cuaucucccauaaugcuuagc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-5408a-3p

Accession MIMAT0022025
Previous IDsaca-miR-5408a*
Sequence

52 - 

uaagacuucugggaguugaag

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).