Stem-loop sequence aca-mir-5407

AccessionMI0018910 (change log)
DescriptionAnolis carolinensis miR-5407 stem-loop
Stem-loop
   gac    c g           u  agu     uuu  uuu 
5'    gguu u ucuuucggauu uc   cacag   cc   g
      |||| | ||||||||||| ||   |||||   ||    
3'    ccaa a agaaagccuaa ag   guguc   gg   u
   uuc    - g           u  ggu     ugc  ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343282.1: 1475305-1475385 [-]
sense
ENSACAT00000000953 ; UFD1L-201; 3'UTR (exon 12)
Clustered miRNAs
< 10kb from aca-mir-5407
aca-mir-5407GL343282.1: 1475305-1475385 [-]
aca-mir-5406GL343282.1: 1474906-1474981 [-]
aca-mir-5408aGL343282.1: 1472516-1472599 [-]
aca-mir-5452GL343282.1: 1468391-1468478 [+]
Database links

Mature sequence aca-miR-5407-5p

Accession MIMAT0022022
Previous IDsaca-miR-5407
Sequence

13 - 

uuucggauuuucagucacaguu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-5407-3p

Accession MIMAT0022023
Previous IDsaca-miR-5407*
Sequence

50 - 

ucugugugggauaauccgaa

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).