Stem-loop sequence aca-mir-5406

AccessionMI0018909 (change log)
DescriptionAnolis carolinensis miR-5406 stem-loop
Stem-loop
   aca       c       c gg a        --a  u 
5'    guucuuc uuuuaga u  c cuccuaga   uc c
      ||||||| ||||||| |  | ||||||||   || u
3'    caagaag aaaaucu a  g gaggaucu   ag c
   cuc       -       c aa c        aca  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343282.1: 1474906-1474981 [-]
intergenic
Clustered miRNAs
< 10kb from aca-mir-5406
aca-mir-5407GL343282.1: 1475305-1475385 [-]
aca-mir-5406GL343282.1: 1474906-1474981 [-]
aca-mir-5408aGL343282.1: 1472516-1472599 [-]
aca-mir-5452GL343282.1: 1468391-1468478 [+]
Database links

Mature sequence aca-miR-5406-5p

Accession MIMAT0022020
Sequence

11 - 

cuuuuagacuggcacuccuaga

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-5406-3p

Accession MIMAT0022021
Sequence

48 - 

uaggagcgaaacucuaaaaga

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).