Stem-loop sequence aca-mir-449c

AccessionMI0018905 (change log)
DescriptionAnolis carolinensis miR-449c stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
    ug     u   c      cuc      a     u  a 
5' g  auggu ugg agugua   uuaguu gcugu gu u
   |  ||||| ||| ||||||   |||||| ||||| ||  
3' c  uauua acc ucacau   aaucaa cgaca ua a
    gu     u   u      --a      -     u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 2666231-2666305 [+]
sense
ENSACAT00000015475 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from aca-mir-449c
aca-mir-449bchr2: 2663679-2663768 [+]
aca-mir-449achr2: 2665566-2665652 [+]
aca-mir-449cchr2: 2666231-2666305 [+]
Database links

Mature sequence aca-miR-449c-5p

Accession MIMAT0022014
Previous IDsaca-miR-449c
Sequence

10 - 

uggcaguguacucuuaguuagcu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-449c-3p

Accession MIMAT0022015
Previous IDsaca-miR-449c*
Sequence

48 - 

gcaacuaaauacacuuccaua

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).