Stem-loop sequence aca-mir-5397

AccessionMI0018899 (change log)
DescriptionAnolis carolinensis miR-5397 stem-loop
Stem-loop
   aguu   c   -   cu  u    c       uuu    c       u aau 
5'     guu gca gcu  ca guua gcagaag   gcuu aucaggc g   a
       ||| ||| |||  || |||| |||||||   |||| ||||||| |    
3'     cga cgu cga  gu caau cgucuuc   cgaa ugguccg c   u
   -cuu   a   u   ac  c    c       ---    a       u ccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 92804639-92804739 [+]
intergenic
Database links

Mature sequence aca-miR-5397-5p

Accession MIMAT0022004
Previous IDsaca-miR-5397
Sequence

22 - 

uacgcagaaguuugcuucauca

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-5397-3p

Accession MIMAT0022005
Previous IDsaca-miR-5397*
Sequence

61 - 

cugguaaagccuucugccuaa

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).