Stem-loop sequence aca-mir-99a

AccessionMI0018894 (change log)
DescriptionAnolis carolinensis miR-99a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
         a         uc   u      -  gaa 
5' ggcaua acccguaga  cga cuugug gu   g
   |||||| |||||||||  ||| |||||| ||    
3' cugugu uggguaucu  gcu gaacac ua   u
         c         uc   c      g  aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr3: 154034468-154034536 [-]
sense
ENSACAT00000020172 ; aca-mir-99a-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-99a
aca-mir-99achr3: 154034468-154034536 [-]
aca-let-7c-1chr3: 154032171-154032268 [-]
Database links

Mature sequence aca-miR-99a-5p

Accession MIMAT0021996
Previous IDsaca-miR-99a
Sequence

7 - 

aacccguagauccgaucuugug

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-99a-3p

Accession MIMAT0021997
Previous IDsaca-miR-99a*
Sequence

44 - 

caagcucgcuucuauggguc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).