Stem-loop sequence aca-mir-9-3

AccessionMI0018890 (change log)
DescriptionAnolis carolinensis miR-9-3 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention aca-mir-9-3
(2 sentences)

Stem-loop
   ca       c  uucuc       a       g      u  g 
5'   gggccgg uc     uuugguu ucuagcu uaugag gc c
     ||||||| ||     ||||||| ||||||| |||||| || c
3'   cccggcc ag     aagccaa agaucga auacuu ug u
   ag       a  caugc       g       a      -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aca-miR-9-5p

Accession MIMAT0021990
Previous IDsaca-miR-9
Sequence

16 - 

ucuuugguuaucuagcugua

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-9-3-3p

Accession MIMAT0021992
Previous IDsaca-miR-9-3*
Sequence

54 - 

uaaagcuagagaaccgaacgua

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).