Stem-loop sequence aca-mir-9-2

AccessionMI0018889 (change log)
DescriptionAnolis carolinensis miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention aca-mir-9-2
(2 sentences)

Stem-loop
   ga   c        uc               g     -gu  a 
5'   ggg cguuucug  uuugguuaucuagcu uauga   gu a
     ||| ||||||||  ||||||||||||||| |||||   || u
3'   cuc guaaagau  aagccaauagaucga auacu   ca c
   -c   a        ga               a     acc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343444.1: 370592-370678 [+]
antisense
ENSACAT00000018981 ; aca-mir-9-2-201; exon 1
Database links

Mature sequence aca-miR-9-5p

Accession MIMAT0021990
Previous IDsaca-miR-9
Sequence

15 - 

ucuuugguuaucuagcugua

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).