Stem-loop sequence aca-mir-9-1

AccessionMI0018888 (change log)
DescriptionAnolis carolinensis miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention aca-mir-9-1
(2 sentences)

Stem-loop
   g    c     g   uc               g      u ug 
5'  gaag gaguu uug  uuugguuaucuagcu uaugag g  u
    |||| ||||| |||  ||||||||||||||| |||||| |  u
3'  cuuc cucaa aau  aagccaauagaucga auacuu c  g
   a    -     a   ga               a      - ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 21612993-21613079 [-]
antisense
ENSACAT00000018140 ; aca-mir-9-1-201; exon 1
Database links

Mature sequence aca-miR-9-5p

Accession MIMAT0021990
Previous IDsaca-miR-9
Sequence

16 - 

ucuuugguuaucuagcugua

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-9-1-3p

Accession MIMAT0021991
Previous IDsaca-miR-9-1*
Sequence

53 - 

auaaagcuagauaaccgaaa

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).