Stem-loop sequence aca-mir-727

AccessionMI0018886 (change log)
DescriptionAnolis carolinensis miR-727 stem-loop
Gene family MIPF0001371; mir-727
Stem-loop
   uugcc       u      c            cu  -    - - g  aaa 
5'      cuguaug cauuuu agucuucaauuc  cc cagc c c uu   u
        ||||||| |||||| ||||||||||||  || |||| | | ||    
3'      gacgugu guaaaa ucagaaguugag  gg guug g g aa   g
   acuua       c      a            -c  a    a u g  aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr3: 28511667-28511766 [+]
sense
Database links

Mature sequence aca-miR-727-5p

Accession MIMAT0021987
Previous IDsaca-miR-727*
Sequence

19 - 

ucagucuucaauuccuccca

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-727-3p

Accession MIMAT0021988
Previous IDsaca-miR-727
Sequence

61 - 

guugaggcgaguugaagacu

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).