Stem-loop sequence aca-mir-7-3

AccessionMI0018884 (change log)
DescriptionAnolis carolinensis miR-7-3 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   -uu   cu     u  u  a     a       u      c  u  u 
5'    gcc  gcuuc ua gg agacu gugauuu guuguu ug ag u
      |||  ||||| || || ||||| ||||||| |||||| || || c
3'    cgg  cgggg au cc ucuga cacugaa caacag ac uc a
   cuc   uc     u  u  g     -       -      c  -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343844.1: 159566-159658 [-]
sense
ENSACAT00000020452 ; aca-mir-7-3-201; exon 1
Database links

Mature sequence aca-miR-7-5p

Accession MIMAT0021983
Previous IDsaca-miR-7
Sequence

16 - 

uggaagacuagugauuuuguugu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).