Stem-loop sequence aca-mir-7-2

AccessionMI0018883 (change log)
DescriptionAnolis carolinensis miR-7-2 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   -----ugu      a  u        a     a       u      --     a 
5'         uggccu gu cugugugg agacu gugauuu guuguu  uuuag u
           |||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'         accgga ca gguauacc ucuga cgcuaaa caacag  aaauc a
   ucuccaau      -  c        a     -       -      uu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 42574641-42574742 [+]
sense
ENSACAT00000018128 ; aca-mir-7-2-201; exon 1
ENSACAT00000001642 ; HNRNPK-201; intron 14
Database links

Mature sequence aca-miR-7-5p

Accession MIMAT0021983
Previous IDsaca-miR-7
Sequence

19 - 

uggaagacuagugauuuuguugu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-7-2-3p

Accession MIMAT0021985
Previous IDsaca-miR-7-2*
Sequence

61 - 

caacaaaucgcagucuaccau

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).