Stem-loop sequence aca-mir-7-1

AccessionMI0018882 (change log)
DescriptionAnolis carolinensis miR-7-1 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   ---ug     --    u        a  a   g      u     u    cuu 
5'      uggcu  gguu cugggugg ag cua ugauuu guugu cuga   a
        |||||  |||| |||||||| || ||| |||||| ||||| ||||    
3'      gccga  ccag gacccgcc uc gau gcuaaa caaca gauu   u
   cacga     ca    c        g  c   -      -     -    uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aca-miR-7-5p

Accession MIMAT0021983
Previous IDsaca-miR-7
Sequence

18 - 

uggaagacuagugauuuuguugu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-7-1-3p

Accession MIMAT0021984
Previous IDsaca-miR-7-1*
Sequence

59 - 

caacaaaucguagccugccgc

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).