Stem-loop sequence aca-mir-551

AccessionMI0018881 (change log)
DescriptionAnolis carolinensis miR-551 stem-loop
Gene family MIPF0000360; mir-551
Stem-loop
   ----------ca u      a         gu     ga a   - gugaa 
5'             g ggcucc gaaaucaag  ugggu  g ccu c     c
               | |||||| |||||||||  |||||  | ||| |      
3'             c ucgagg cuuugguuc  accca  c gga g     a
   cuuauuuaggag u      a         au     -g -   a gucag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr3: 8819992-8820082 [-]
sense
Database links

Mature sequence aca-miR-551

Accession MIMAT0021982
Sequence

52 - 

gcgacccauacuugguuucag

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).