Stem-loop sequence aca-mir-499

AccessionMI0018880 (change log)
DescriptionAnolis carolinensis miR-499 stem-loop
Gene family MIPF0000173; mir-499
Stem-loop
   -cu       -    c   ua       c           gaaaau 
5'    ugagggg gagg agu  agacuug agugauguuua      u
      ||||||| |||| |||  ||||||| |||||||||||       
3'    auuccuu cuuc ucg  ucugaau ucacuacaagu      u
   ucu       u    a   ug       u           acauca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 135451067-135451158 [+]
sense
ENSACAT00000008225 ; MYH7B-201; intron 18
Database links

Mature sequence aca-miR-499-5p

Accession MIMAT0021980
Sequence

17 - 

uuaagacuugcagugauguuua

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-499-3p

Accession MIMAT0021981
Sequence

55 - 

aacaucacuuuaagucugugcu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).