Stem-loop sequence aca-mir-490

AccessionMI0018878 (change log)
DescriptionAnolis carolinensis miR-490 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop
   ugaua  uu  u  c      c      --         g   caagauu 
5'      ug  ca gc ucaaca caugga  ucuccaggu ggu       a
        ||  || || |||||| ||||||  ||||||||| |||       u
3'      ac  gu cg aguugu guaccu  ggaggucca cca       a
   cgaac  uu  -  -      c      ca         a   caaagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343419.1: 442466-442564 [-]
sense
ENSACAT00000020247 ; aca-mir-490-201; exon 1
Database links

Mature sequence aca-miR-490-5p

Accession MIMAT0021976
Sequence

22 - 

ccauggaucuccaggugggu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-490-3p

Accession MIMAT0021977
Sequence

61 - 

caaccuggaggacuccaugcugu

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).